SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


fructose-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIID of the [category|SW 1.2.2|PTS]
29.94 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
fructose uptake and phosphorylation
fructose-specific fructose-specific [category|SW 1.2.2|PTS], EIID component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of fructose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,760,233 → 2,761,060

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, mannose family [Pubmed|10627040]
  • [SW|Domains]

  • PTS EIID domain (aa 5-274) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|1924373], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7592486], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR]: activation, [Pubmed|1900939], in [regulon|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR regulon]
  • regulation

  • induced in the presence of fructose ([protein|search|LevR]) [Pubmed|1900939]
  • view in new tab

    Biological materials


  • BKE27040 (Δ[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTTCCCCCTCAT, downstream forward: _UP4_TAAGGTGTGTGAAGGAAAGA
  • BKK27040 (Δ[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTTCCCCCTCAT, downstream forward: _UP4_TAAGGTGTGTGAAGGAAAGA
  • References

  • 10627040,2117666,1924373,7592486,1900939