SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


13.00 kDa
protein length
114 aa Sequence Blast
gene length
345 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    2,099,446 → 2,099,790

    The protein


  • [PDB|3DCX] (from Shewanella loihica, 32% identity) [pubmed|19913036]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by alkali shock ([protein|search|SigW]) [Pubmed|11866510]
  • view in new tab

    Biological materials


  • MGNA-B418 (yozO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19290 (Δ[gene|F2037CBE540F5D57FA93E3504960C771A55DC29C|yozO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGAACCCCTCTTTC, downstream forward: _UP4_TGAATATTTGATGAGCCAGC
  • BKK19290 (Δ[gene|F2037CBE540F5D57FA93E3504960C771A55DC29C|yozO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGAACCCCTCTTTC, downstream forward: _UP4_TGAATATTTGATGAGCCAGC
  • References

  • 11866510,19913036