SubtiBank SubtiBank


part of the yqbN pseudogene
0.00 kDa
protein length
gene length
192 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    2,677,466 → 2,677,657

    Biological materials


  • BKE26039 (Δ[gene|F1D7A6070371117FEBA27676B2A99D2E77D42B13|yqbN/1]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCGTCTTTTACTAGTTTTT, downstream forward: _UP4_GCGAAGAAGGGAGGTAATTA
  • BKK26039 (Δ[gene|F1D7A6070371117FEBA27676B2A99D2E77D42B13|yqbN/1]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCGTCTTTTACTAGTTTTT, downstream forward: _UP4_GCGAAGAAGGGAGGTAATTA