SubtiBank SubtiBank
iolS

iolS

similar to dehydrogenase, may be involved in myo-inositol catabolism
locus
BSU_39780
pI
5.38
mw
35.01 kDa
protein length
310 aa Sequence Blast
gene length
933 bp Sequence Blast
function
unknown, may be involved in myo-inositol catabolism
product
unknown
essential
no
synonyms
yxbF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    4,085,608 → 4,086,540

    The protein

    Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|YhdN], [protein|B73D729097C00BE6F3C7FF1708738783EE93C6FB|YccK]
  • [protein|B0897643562CDB25547223CCB9CFD0F9E78710E2|YqkF]:
  • Structure

  • [PDB|1PZ0] [Pubmed|15019785]
  • Expression and Regulation

    Operons

    genes
    [gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]-[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9226270]
  • view in new tab

    Biological materials

    Mutant

  • BKE39780 (Δ[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT, downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT
  • BKK39780 (Δ[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT, downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,15019785,9887260,27941785