SubtiBank SubtiBank
iolS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolS

similar to dehydrogenase, may be involved in myo-inositol catabolism
locus
BSU_39780
pI
5.38
mw
35.01 kDa
protein length
310 aa Sequence Blast
gene length
933 bp Sequence Blast
function
unknown, may be involved in myo-inositol catabolism
product
unknown
essential
no
synonyms
yxbF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    4,085,608 → 4,086,540

    The protein

    Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|YhdN], [protein|B73D729097C00BE6F3C7FF1708738783EE93C6FB|YccK]
  • [protein|B0897643562CDB25547223CCB9CFD0F9E78710E2|YqkF]:
  • Structure

  • [PDB|1PZ0] [Pubmed|15019785]
  • Expression and Regulation

    Operons

    genes
    [gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]-[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9226270]
  • view in new tab

    Biological materials

    Mutant

  • BKE39780 (Δ[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT, downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT
  • BKK39780 (Δ[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT, downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,15019785,9887260,27941785