SubtiBank SubtiBank
yitF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitF

similar to mandelate racemase
locus
BSU_10970
pI
7.53
mw
41.89 kDa
protein length
371 aa Sequence Blast
gene length
1116 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,174,861 → 1,175,976

    The protein

    Protein family

  • [SW|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
  • Structure

  • [PDB|2GDQ]
  • Expression and Regulation

    Operons

    genes
    [gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]-[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B180 (yitF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1179 NBRP B. subtilis, Japan]
  • BKE10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG, downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
  • BKK10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG, downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
  • References

  • 16497325,15699190