SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to mandelate racemase
41.89 kDa
protein length
371 aa Sequence Blast
gene length
1116 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,174,861 → 1,175,976

    The protein

    Protein family

  • [SW|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
  • Structure

  • [PDB|2GDQ]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials


  • MGNA-B180 (yitF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG, downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
  • BKK10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG, downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
  • References

  • 16497325,15699190