SubtiBank SubtiBank
mccA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mccA

O-acetylserine-thiol-lyase
locus
BSU_27260
pI
5.23
mw
32.86 kDa
protein length
307 aa Sequence Blast
gene length
921 bp Sequence Blast
function
methionine-to-cysteine conversion
product
O-acetylserine-thiol-lyase
essential
no
synonyms
yrhA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • Gene

    Coordinates
    2,786,142 → 2,787,065

    Phenotypes of a mutant

  • a [gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA] [gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK] double mutant is auxotrophic for cysteine [pubmed|17056751]
  • The protein

    Catalyzed reaction/ biological activity

  • L-homocysteine + O-acetyl-L-serine --> acetate + H+ + L,L-cystathionine (according to UniProt)
  • Protein family

  • Cysteine synthase/cystathionine beta-synthase family (with [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|CysK] and [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|YtkP], according to UniProt)
  • Paralogous protein(s)

  • [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|CysK], [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|YtkP]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|4QL4] (from B. anthracis, 63% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]-[gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]-[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]-[gene|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB]-[gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]
    description
    [Pubmed|17056751]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,16885442], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A849 (yrhA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/849 NBRP B. subtilis, Japan]
  • 1A945 ( ''mccA''::''kan''), [Pubmed|17056751], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A945&Search=1A945 BGSC]
  • BKE27260 (Δ[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCCTCCTCCTTA, downstream forward: _UP4_CAAATATACGAAGGAGGCAT
  • BKK27260 (Δ[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCCTCCTCCTTA, downstream forward: _UP4_CAAATATACGAAGGAGGCAT
  • References

  • 17056751,16513748,16885442,12642660