SubtiBank SubtiBank
ypeB [2018-12-07 16:31:08]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypeB [2018-12-07 16:31:08]

[SW|germination] protein, essential for [protein|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|SleB] assembly in spores
locus
BSU22920
pI
6.31
mw
51.02 kDa
protein length
450 aa Sequence Blast
gene length
1350 bp Sequence Blast
function
assembly of [protein|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|SleB]
product
[SW|germination] protein
essential
no
synonyms
joeB,yzuA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,397,765 → 2,399,117

    The protein

    Protein family

  • ypeB family (according to Swiss-Prot)
  • [SW|Domains]

  • has a membrane-spanning domain in the N-terminal region [Pubmed|23335419]
  • Structure

  • [PDB|5BOI] (C-terminal domain of B. megaterium YpeB, aa 211-450, 53% identity)
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419]
  • Expression and Regulation

    Operons

    genes
    [gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]-[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]
    description
    [Pubmed|15699190,10197998]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10197998], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10197998]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A400 (ypeB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/400 NBRP B. subtilis, Japan]
  • BKE22920 (Δ[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCACACCTCTTTTT, downstream forward: _UP4_TAAAAACAGGAGGAAAGGAC
  • BKK22920 (Δ[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCACACCTCTTTTT, downstream forward: _UP4_TAAAAACAGGAGGAAAGGAC
  • References

  • 15699190,10197998,23335419,23543708,24752279,25384476,10658652,12177332,26731423