SubtiBank SubtiBank
ypeB [2018-12-07 16:07:24]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypeB [2018-12-07 16:07:24]

germination protein, essential for SleB assembly in spores
51.02 kDa
protein length
450 aa Sequence Blast
gene length
1350 bp Sequence Blast
assembly of SleB
germination protein
joeB, yzuA

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,397,765 → 2,399,117

    The protein

    Protein family

  • ypeB family (according to Swiss-Prot)
  • [SW|Domains]

  • has a membrane-spanning domain in the N-terminal region [Pubmed|23335419]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10197998], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10197998]
  • view in new tab

    Biological materials


  • MGNA-A400 (ypeB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22920 (Δ[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCACACCTCTTTTT, downstream forward: _UP4_TAAAAACAGGAGGAAAGGAC
  • BKK22920 (Δ[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCACACCTCTTTTT, downstream forward: _UP4_TAAAAACAGGAGGAAAGGAC
  • References

  • 15699190,10197998,23335419,23543708,24752279,25384476,10658652,12177332,26731423