SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ribose ABC transporter (permease)
33.63 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
ribose uptake
ribose ABC transporter (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of ribose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,705,165 → 3,706,133

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials


  • BKE35950 (Δ[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACCGCCCTCCCGTG, downstream forward: _UP4_AAGTCAGCTTAGGAGGGTTT
  • BKK35950 (Δ[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACCGCCCTCCCGTG, downstream forward: _UP4_AAGTCAGCTTAGGAGGGTTT
  • References

  • 10092453,16872404,7511775,7592460,7921236