SubtiBank SubtiBank
yjcO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcO

unknown
locus
BSU_11930
pI
7.91
mw
17.91 kDa
protein length
153 aa Sequence Blast
gene length
462 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,265,887 → 1,266,348

    Biological materials

    Mutant

  • MGNA-B259 (yjcO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1258 NBRP B. subtilis, Japan]
  • BKE11930 (Δ[gene|F1114D7182D6D03E75DF962245ABBA373BA56C3D|yjcO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGCTTTCCCTCCTGA, downstream forward: _UP4_TAAAATGGGGGGCAGGATCG
  • BKK11930 (Δ[gene|F1114D7182D6D03E75DF962245ABBA373BA56C3D|yjcO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGCTTTCCCTCCTGA, downstream forward: _UP4_TAAAATGGGGGGCAGGATCG