SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


17.91 kDa
protein length
153 aa Sequence Blast
gene length
462 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,265,887 → 1,266,348

    Biological materials


  • MGNA-B259 (yjcO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11930 (Δ[gene|F1114D7182D6D03E75DF962245ABBA373BA56C3D|yjcO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGCTTTCCCTCCTGA, downstream forward: _UP4_TAAAATGGGGGGCAGGATCG
  • BKK11930 (Δ[gene|F1114D7182D6D03E75DF962245ABBA373BA56C3D|yjcO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGCTTTCCCTCCTGA, downstream forward: _UP4_TAAAATGGGGGGCAGGATCG