SubtiBank SubtiBank
corA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

corA

general stress protein, similar to magnesium transporter
locus
BSU_24740
pI
9.54
mw
37.55 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqhC,yqxL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.4|Metal ion homeostasis/ Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,560,489 → 2,561,442

    The protein

    Catalyzed reaction/ biological activity

  • there is no indication for an implication of [protein|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|CorA] in Mg2 uptake (based on mutant phenotypes, failure to complement mutants defective in Mg2 uptake) [Pubmed|24415722]
  • Protein family

  • CorA metal ion transporter (MIT) (TC 1.A.35) family (together with [protein|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|YfjQ]) (according to UniProt)
  • Structure

  • [PDB|5JTG] (from Themotoga maritima, C-terminal domain, aa 122-297, 28% identity)
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation

    Operons

    genes
    [gene|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|corA]
    description
    [Pubmed|2507524]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C473 (yqxL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2471 NBRP B. subtilis, Japan]
  • BKE24740 (Δ[gene|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|corA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAGCTCCTCCAAAC, downstream forward: _UP4_TAGGATGTTTCATATTTTGT
  • BKK24740 (Δ[gene|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|corA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAGCTCCTCCAAAC, downstream forward: _UP4_TAGGATGTTTCATATTTTGT
  • References

    Reviews

  • 24079267
  • Original publications

  • 15231793,15856219,2507524,16267290,15805528,24415722,26731423