SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


translesion synthesis (TLS-) DNA polymerase Y2
45.78 kDa
protein length
412 aa Sequence Blast
gene length
1239 bp Sequence Blast
UV-targeted mutagenesis
translesion synthesis (TLS-) DNA polymerase Y2

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,464,562 → 2,465,800

    Phenotypes of a mutant

  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • increased sensitivity to Cr(VI) [pubmed|30745368]
  • The protein

    Catalyzed reaction/ biological activity

  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • required for Cr(VI)-induced mutagenesis [pubmed|30745368]
  • Protein family

  • [SW|DNA polymerase type-Y family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C87D33852F263A553CA747608E6200E4AD8344B5|PolY1], [protein|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|UvrX]
  • [SW|Domains]

  • [SW|UmuC domain] (aa 7-192) (according to UniProt)
  • Structure

  • [PDB|4DEZ] (from Mycobacterium smegmatis, 30% identity) [pubmed|22868761]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|15469515,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|15469515,16267290]
  • view in new tab

    Biological materials


  • MGNA-C403 (yqjW::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1505 (''polY2''::''kan''), available in [SW|Stülke] lab [pubmed|31948638]
  • BKE23710 (Δ[gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACACCTCTAAAAAGA, downstream forward: _UP4_GCTAAAATAGGGGGGCATTA
  • BKK23710 (Δ[gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACACCTCTAAAAAGA, downstream forward: _UP4_GCTAAAATAGGGGGGCATTA
  • References


  • 22933559
  • Original publications

  • 16267290,12644484,15469515,16045613,19924481,23686288,30054368,30096406,22868761,30745368,30916324,31948638