SubtiBank SubtiBank
polY2
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

polY2

translesion synthesis (TLS-) DNA polymerase Y2
locus
BSU_23710
pI
9.53
mw
45.78 kDa
protein length
412 aa Sequence Blast
gene length
1239 bp Sequence Blast
function
UV-targeted mutagenesis
product
translesion synthesis (TLS-) DNA polymerase Y2
essential
no
synonyms
yqjW

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,464,562 → 2,465,800

    Phenotypes of a mutant

  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • increased sensitivity to Cr(VI) [pubmed|30745368]
  • The protein

    Catalyzed reaction/ biological activity

  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • required for Cr(VI)-induced mutagenesis [pubmed|30745368]
  • Protein family

  • [SW|DNA polymerase type-Y family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C87D33852F263A553CA747608E6200E4AD8344B5|PolY1], [protein|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|UvrX]
  • [SW|Domains]

  • [SW|UmuC domain] (aa 7-192) (according to UniProt)
  • Structure

  • [PDB|4DEZ] (from Mycobacterium smegmatis, 30% identity) [pubmed|22868761]
  • Expression and Regulation

    Operons

    genes
    [gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]-[gene|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|yqjX]-[gene|5B8A6D282E34683726BD6C36E09A6C36E8F99795|yqjY]-[gene|9F88AC3A792F4EE8AA853849BBCF5065717B1D8B|yqjZ]-[gene|3ECD25A4ED9556E74112285B11FC180A7091D730|yqkA]-[gene|DC1C1D4BE1A7F4E28792A2B8273AFE2C7F90E58C|yqkB]-[gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|15469515,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|15469515,16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C403 (yqjW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2401 NBRP B. subtilis, Japan]
  • GP1505 (''polY2''::''kan''), available in [SW|Stülke] lab [pubmed|31948638]
  • BKE23710 (Δ[gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACACCTCTAAAAAGA, downstream forward: _UP4_GCTAAAATAGGGGGGCATTA
  • BKK23710 (Δ[gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACACCTCTAAAAAGA, downstream forward: _UP4_GCTAAAATAGGGGGGCATTA
  • References

    Reviews

  • 22933559
  • Original publications

  • 16267290,12644484,15469515,16045613,19924481,23686288,30054368,30096406,22868761,30745368,30916324,31948638