desR [2019-08-28 12:53:52]

two-component response regulator, regulation of cold shock expression of des

Locus: BSU_19200

Isoelectric point: 4.89

Molecular weight: 22.03 kDa

Protein length: 199 aa

Gene length: 600 bp

Function: regulation of cold shock expression of des

Product: two-component response regulator

Essential: no

Synonyms: yocG

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Lipid metabolism → Lipid metabolism/ other
• Information processing → Regulation of gene expression → Transcription factors and their control → Two-component system response regulators
• Lifestyles → Coping with stress → Cold stress proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Asp residue

Gene

Coordinates: 2,091,705 → 2,092,304

The protein

Catalyzed reaction/ biological activity

• transcription activation of the des operon when phosphorylated by DesK

Paralogous protein(s)

• YvfU

Modification

• phosphorylated by DesK on an Asp residue

Structure

• 5IUJ (DesK-DesR complex in the phosphotransfer state with low Mg2+ [20 mM]) PubMed
• 5IUK (DesK-DesR complex in the phosphotransfer state with high Mg2+ [150 mM] and BeF3) PubMed
• 5IUN (DesK-DesR complex in the phosphatase state) PubMed

Expression and Regulation

Operons

• Genes: desK-desR
  Description: PubMed

  Regulation

  • induced by cold shock (12-fold) PubMed

Biological materials

Mutant

• MGNA-A320 (yocG::erm), available at the NBRP B. subtilis, Japan
• BKE19200 (ΔdesR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AATCATATAAGCCATCCTTT, downstream forward: _UP4_TAAAAAAGGATCTTGGCATC
• BKK19200 (ΔdesR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AATCATATAAGCCATCCTTT, downstream forward: _UP4_TAAAAAAGGATCTTGGCATC

Labs working on this gene/protein

• Diego de Mendoza, Universidad Nacional de Rosario, Argentine homepage

References

Loading