SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component response regulator, regulation of cold shock expression of [gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des]
22.03 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
regulation of cold shock expression of [gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des]
two-component response regulator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    2,091,705 → 2,092,304

    The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the ''[gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des]'' operon when phosphorylated by [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]
  • Paralogous protein(s)

  • [protein|5BB2B90D5DDD50DD9B4EF9E69925FCBFA642222B|YvfU]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-117) (according to UniProt)
  • [SW|HTH luxR-type domain] (aa 131-196) (according to UniProt)
  • Modification

  • phosphorylated by [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK] on an Asp residue
  • Structure

  • [PDB|5IUJ] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR] complex in the phosphotransfer state with low Mg2+ [20 mM]) [Pubmed|27938660]
  • [PDB|5IUK] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR] complex in the phosphotransfer state with high Mg2+ [150 mM] and BeF3) [Pubmed|27938660]
  • [PDB|5IUN] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR] complex in the phosphatase state) [Pubmed|27938660]
  • Expression and Regulation




  • induced by cold shock (12-fold) [Pubmed|12399512]
  • view in new tab

    Biological materials


  • MGNA-A320 (yocG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19200 (Δ[gene|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATATAAGCCATCCTTT, downstream forward: _UP4_TAAAAAAGGATCTTGGCATC
  • BKK19200 (Δ[gene|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATATAAGCCATCCTTT, downstream forward: _UP4_TAAAAAAGGATCTTGGCATC
  • labs

  • [SW|Diego de Mendoza], Universidad Nacional de Rosario, Argentine [ homepage]
  • References

  • 10094672,12399512,19595746,11285232,17087771,12207704,25406381,27938660,29269314