SubtiBank SubtiBank
ribA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ribA

GTP cyclohydrolase II/ 3,4-dihydroxy-2-butanone 4-phosphate synthase
locus
BSU_23260
pI
5.58
mw
43.96 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
function
riboflavin biosynthesis
product
GTP cyclohydrolase II/ 3,4-dihydroxy-2-butanone 4-phosphate synthase
essential
no
ec
3.5.4.25
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.2|Biosynthesis/ acquisition of riboflavin/ FAD]
  • Gene

    Coordinates
    2,428,389 → 2,429,585

    The protein

    Catalyzed reaction/ biological activity

  • D-ribulose 5-phosphate --> (2S)-2-hydroxy-3-oxobutyl phosphate + formate + H+ (according to UniProt)
  • GTP + 3 H2O --> 2,5-diamino-6-hydroxy-4-(5-phosphoribosylamino)-pyrimidine + diphosphate + formate + 2 H+ (according to UniProt)
  • Protein family

  • N-terminal part: DHBP synthase family (single member, according to UniProt)
  • C-terminal part: GTP cyclohydrolase II family (single member, according to UniProt)
  • Structure

  • [PDB|2BZ0] (from ''E. coli'', 54% identity, 69% similarity to the C-terminal domain) [Pubmed|16115872]
  • Expression and Regulation

    Operons

    genes
    [gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
    description
    [Pubmed|8159171]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8159171], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|FMN-box|FMN-box]: transcription termination, via [SW|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|RibR], in [regulon|FMN-box|FMN-box]
  • regulation

  • expressed in the absence of FMN ([SW|FMN-box]) [Pubmed|15808508]
  • the [SW|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE23260 (Δ[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGAAACATGCAAATCTTCC, downstream forward: _UP4_TAATCACAAATATCACAAAA
  • BKK23260 (Δ[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGAAACATGCAAATCTTCC, downstream forward: _UP4_TAATCACAAATATCACAAAA
  • References

  • 19583770,12456892,15808508,8159171,7934829,7934830,16115872,23270261,24442413,26280801,26494285