SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


anti-[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD], regulation of flagellin, [category|SW 4.1.1|Motility and chemotaxis]
9.86 kDa
protein length
gene length
267 bp Sequence Blast
control of [protein|search|SigD ]activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,640,285 → 3,640,551

    The protein

    Protein family

  • flgM family (single member, according to UniProt)
  • Structure

  • [PDB|1RP3] ([protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-[protein|F03144BF8A187C8931938A21433431B8961E8EE7|FlgM] complex from ''Aqufex aeolicus'', 34% identity) [Pubmed|15068809]
  • [SW|Localization]

  • secreted and extracellularly degraded by the proteases [protein|F2E3FF41357C672F80012CFE3076F890407B8B4A|Epr] and [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] [Pubmed|25313396]
  • secretion of FlgM requires the [protein|EB815705133E3318F655F6024B7D9BA587FD1DDA|FliF]/[protein|8DDCC3D139ACCB635BF014946E1282A72D535390|FliG] basal body proteins, the flagellar type III export apparatus components [protein|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|FliZ], [protein|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|FliP], [protein|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|FliQ], [protein|9856F25F23264AD1402A85AE9E25F10B68CAD739|FliR], [protein|974FA844E263AA694477992FA50468CB8EFAB807|FlhA], and [protein|68DB2871A88535714C84FE86006AB54CEB6F0EAD|FlhB], and the substrate specificity switch regulator [protein|42277DE1030E6FEB416EAE381CD40A54D49736FF|FliK] [Pubmed|25313396]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    view in new tab

    view in new tab

    Biological materials


  • 1A764 (no resistance), [Pubmed|8045879], available at [ BGSC]
  • BKE35430 (Δ[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGATTCCTCTCGCTTT, downstream forward: _UP4_AAGCAATAAAAAAGGAGAAA
  • BKK35430 (Δ[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGATTCCTCTCGCTTT, downstream forward: _UP4_AAGCAATAAAAAAGGAGAAA
  • References


  • 25251856
  • Original Publications

  • 8955328,19898538,8412657,8045879,20233303,10207036,8655488,23352839,21736639,25313396,26244495,15068809,29061663