SubtiBank SubtiBank
mcpA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mcpA

membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein
locus
BSU_31240
pI
4.99
mw
72.22 kDa
protein length
661 aa Sequence Blast
gene length
1986 bp Sequence Blast
function
control of chemotaxis
product
methyl-accepting chemotaxis protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,206,169 → 3,208,154

    The protein

    Paralogous protein(s)

  • [protein|E4E1020B799A1B403BDB4847B91B02D64D161AF3|McpB], [protein|4CD44AD8FE68516C84889EAA2137828E06B8A30B|TlpB], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|TlpA]
  • [SW|Domains]

  • [SW|Cache domain] (aa 152-228) (according to UniProt)
  • [SW|HAMP domain] (aa 303-355) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 374-610) (according to UniProt)
  • Modification

  • deamination of Gln-586, Gln-593, and Gln-594 (by [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD]) [Pubmed|22931217]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711,21515776]
  • Expression and Regulation

    Operons

    genes
    [gene|1DE26CDEE952142C1303C822F0E2A63AE09F721B|tlpA]-[gene|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA]
    description
    [Pubmed|8188684]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8188684], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • in minimal medium, McpA is present with 15,900 +/- 3,000 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • BKE31240 (Δ[gene|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTCATTTCTCCTTTT, downstream forward: _UP4_TAATAAGCCTTAACACCCAA
  • BKK31240 (Δ[gene|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTCATTTCTCCTTTT, downstream forward: _UP4_TAATAAGCCTTAACACCCAA
  • References

  • 8251536,6137212,2105313,8188684,2505839,18763711,21515776,22931217