SubtiBank SubtiBank
yraH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraH

unknown
locus
BSU_26940
pI
4.99
mw
14.99 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,752,167 → 2,752,553

    The protein

    Protein family

  • glyoxalase I family (with [protein|54E05955FF1732F434A0FAB08967573B8DD3ADD2|GlxA] and [protein|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|GlxB], according to UniProt)
  • [SW|Domains]

  • [SW|VOC domain] (aa 2-127) (according to UniProt)
  • Structure

  • [PDB|3EY7] (from Vibrio cholerae, 27% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|yraH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A235 (yraH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/235 NBRP B. subtilis, Japan]
  • BKE26940 (Δ[gene|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|yraH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAGTGCCTCCTATA, downstream forward: _UP4_TGATTTTTTGACTCGCAAAA
  • BKK26940 (Δ[gene|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|yraH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAGTGCCTCCTATA, downstream forward: _UP4_TGATTTTTTGACTCGCAAAA