SubtiBank SubtiBank
yukJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yukJ

unknown
locus
BSU31945
pI
4.62
mw
26.00 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,279,573 → 3,280,250

    Expression and Regulation

    Operons

    genes
    [gene|F001D5A254F0E175B4B3A0B54FC4B40AA230997E|yukJ]

    description

  • [pubmed|22383849]
  • view in new tab

    genes
    [gene|2D346CF412BA32EE18111DA930CFA1306F95024B|ald]-[gene|F001D5A254F0E175B4B3A0B54FC4B40AA230997E|yukJ]

    description

  • [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A630 (yukJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/630 NBRP B. subtilis, Japan]
  • BKE31945 (Δ[gene|F001D5A254F0E175B4B3A0B54FC4B40AA230997E|yukJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31945 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCCTCCTTTATG, downstream forward: _UP4_TAAGATAGAAAAAGAGACTG
  • BKK31945 (Δ[gene|F001D5A254F0E175B4B3A0B54FC4B40AA230997E|yukJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31945 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCCTCCTTTATG, downstream forward: _UP4_TAAGATAGAAAAAGAGACTG