SubtiBank SubtiBank
ydzP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydzP

unknown
locus
BSU_05408
pI
10.09
mw
6.90 kDa
protein length
gene length
180 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    587,157 → 587,336

    Biological materials

    Mutant

  • BKE05408 (Δ[gene|EFFD47F919CF7F8FD2A833F11568B9FF86F9FAF7|ydzP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05408 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCACCTAGAAACCAATACA, downstream forward: _UP4_TGAAACAGCTGTCATTCAAA
  • BKK05408 (Δ[gene|EFFD47F919CF7F8FD2A833F11568B9FF86F9FAF7|ydzP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05408 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCACCTAGAAACCAATACA, downstream forward: _UP4_TGAAACAGCTGTCATTCAAA