SubtiBank SubtiBank
yvcD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvcD

unknown
locus
BSU_34810
pI
4.68
mw
55.21 kDa
protein length
484 aa Sequence Blast
gene length
1455 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,576,165 → 3,577,619

    The protein

    [SW|Domains]

  • three [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]-[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21077936], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|21077936]
  • additional information

  • half-life of the mRNA: 1.5 min [PubMed|21077936]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B644 (yvcD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1643 NBRP B. subtilis, Japan]
  • BKE34810 (Δ[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAACTACCCTCCGTTTTA, downstream forward: _UP4_TAGTAAATTTTAAAGAGTTG
  • BKK34810 (Δ[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAACTACCCTCCGTTTTA, downstream forward: _UP4_TAGTAAATTTTAAAGAGTTG
  • References

  • 16479537