SubtiBank SubtiBank
yhjB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhjB

similar to metabolite permease
locus
BSU_10450
pI
9.63
mw
52.60 kDa
protein length
489 aa Sequence Blast
gene length
1470 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.7|Sodium-solute symporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • Gene

    Coordinates
    1,119,162 → 1,120,631

    The protein

    Protein family

  • [SW|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|YodF]
  • Expression and Regulation

    Operons

    genes
    [gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]-[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • GP2395 Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::tet available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-B283 (yhjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1282 NBRP B. subtilis, Japan]
  • BKE10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT, downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
  • BKK10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT, downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
  • References

  • 11948146,22383849