SubtiBank SubtiBank
thiW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiW

thiamine [SW|ECF transporter] (ATP-binding protein)
locus
BSU_13220
pI
5.71
mw
54.48 kDa
protein length
547 aa Sequence Blast
gene length
1644 bp Sequence Blast
function
thiamine uptake
product
thiamine [SW|ECF transporter] (ATP-binding protein)
essential
no
synonyms
ykoD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW 1.2.3.3|Class I ECF transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,388,809 → 1,390,452

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|ABC transporter domain]s (aa 8-250, aa 295-523) (according to UniProt)
  • Structure

  • [PDB|4HUQ] (folate transporter from Lactobacillus brevis, 34% identity) [pubmed|23584589]
  • [SW|Localization]

  • membrane associated (via [protein|9AF27E4CE34B5C4036840A27D93B13213E3324DD|ThiV]-[protein|236095EDE02EC9EA7768D9D30CED2345D3B7A1A9|ThiX]) [Pubmed|16291685]
  • Expression and Regulation

    Operons

    genes
    [gene|57A953B5D71F3FD8269EAF2366B8E2C7A8C79483|thiU]-[gene|9AF27E4CE34B5C4036840A27D93B13213E3324DD|thiV]-[gene|EF69891D9CF0CE57367B38FB3C69DDE1B689FCB7|thiW]-[gene|236095EDE02EC9EA7768D9D30CED2345D3B7A1A9|thiX]
    description
    [Pubmed|16291685]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([protein|search|Thi-box]) [Pubmed|12376536]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A755 (ykoD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/755 NBRP B. subtilis, Japan]
  • BKE13220 (Δ[gene|EF69891D9CF0CE57367B38FB3C69DDE1B689FCB7|thiW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGCTGCTCAACCGTCAGAA, downstream forward: _UP4_ATGGCATTTCAAGAGGAGGT
  • BKK13220 (Δ[gene|EF69891D9CF0CE57367B38FB3C69DDE1B689FCB7|thiW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGCTGCTCAACCGTCAGAA, downstream forward: _UP4_ATGGCATTTCAAGAGGAGGT
  • References

  • 10092453,16291685,12376536,23584589