SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


CTP hydrolase, chromosome positioning near the pole and transport through the polar septum / antagonist of SMC complex to the origin of replication, coordination of early steps in DNA replication with establishment of a medial division site
32.06 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
chromosome positioning before asymmetric septation
centromer-binding protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    4,205,556 → 4,206,404

    Phenotypes of a mutant

  • a [gene|search|whiA ][gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB] double mutant is not viable, this can be suppressed by inactivation of [gene|search|yneA ][pubmed|29378890]
  • The protein

    Catalyzed reaction/ biological activity

  • forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation [pubmed|29244022]
  • inhibits [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] dimerization and concomitant DNA-binding activity by stimulating [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] ATPase activity [Pubmed|21235642]
  • recruits the condensin complex to the DNA origin region [Pubmed|24440393]
  • the dimer binds specifcally to the centromere-like ''parS'' sequence [Pubmed|25572315]
  • prevents Z ring assembly over the bacterial nucleoid and helps fine tune the assembly of the Z ring at midcell during the cell cycle [pubmed|31152469]
  • Protein family

  • ParB family (with [protein|559DEDC9887B811EF80994526256ADC48BA51CE3|Noc], according to UniProt)
  • Paralogous protein(s)

  • [protein|559DEDC9887B811EF80994526256ADC48BA51CE3|Noc]
  • [SW|Domains]

  • N-terminal domain (NTD, aa 1 - 96): binds [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] [pubmed|10064607]
  • Central DNA-binding domain (CDBD, aa 102 - 216): binds parS DNA [pubmed|16306995]
  • C-terminal domain (CTD, aa 233 - 282): binding of non-specific DNA, dimerization, essential for DNA condensation [pubmed|29244022]
  • Structure

  • [PDB|4UMK] (complex with ''parS'' DNA)
  • [PDB|5U1G] [pubmed|28373206]
  • [PDB|5U1J] [pubmed|28373206]
  • [PDB|6SDK] (complex with CDP)
  • [SW|Localization]

  • chromosome centromer [Pubmed|23475963]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • 1S135 ( ''spo0J''::''spec''), [Pubmed| ], available at [ BGSC]
  • 1S136 ( ''spo0J''::''spec''), [Pubmed| ], available at [ BGSC]
  • 1S137 ( ''spo0J''::''spec''), [Pubmed| ], available at [ BGSC]
  • BKE40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT
  • BKK40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT
  • labs

  • [SW|Heath Murray], Centre for Bacterial Cell Biology, Newcastle, UK [ homepage]
  • References


  • 22934648,26706151,28075389,30863373,31254421
  • Original publications

  • 17462018,16677298,12562803,10852876,10482533,9506522,8071208,17932079,21235642,26253537,9663676,11532141,15659156,18854156,9159397,8866474,9778525,16925562,1900505,9364919,9701805,12950914,14651647,19450517,19450516,14563866,23475963,21911367,24440393,24829297,24696501,25071173,25572315,25951515,26295962,28154080,28373206,28407103,29244022,16306995,29378890,30100265,30907359,31152469,16885474,31318889