SubtiBank SubtiBank
pksS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pksS

cytochrome P450, hydroxylase of the polyketide bacillaene produced by the pks cluster
locus
BSU17230
pI
6.12
mw
43.26 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
polyketide synthesis
product
hydroxylase of the polyketide produced by the pks cluster
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,858,566 → 1,859,783

    The protein

    Catalyzed reaction/ biological activity

  • hydroxylation of dihydrobacillaene [Pubmed|17482575]
  • Paralogous protein(s)

  • [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|BioI], [protein|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|YjiB]
  • Structure

  • [PDB|4YZR]
  • Expression and Regulation

    Operons

    genes
    [gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17230 (Δ[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATTCTCCTCGCCT, downstream forward: _UP4_TAACATTCAAAACGCCCCCT
  • BKK17230 (Δ[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATTCTCCTCGCCT, downstream forward: _UP4_TAACATTCAAAACGCCCCCT
  • References

  • 17482575,21821766