SubtiBank SubtiBank
yaaO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yaaO

similar to arginine decarboxylase, affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
locus
BSU_00270
pI
5.71
mw
53.00 kDa
protein length
480 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
product
putative arginine decarboxylase
essential
no
ec
4.1.1.19
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.14|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    37,720 → 39,162

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein

    Catalyzed reaction/ biological activity

  • the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384] and the original paper has been [http://www.cell.com/cell/fulltext/S0092-8674(15)00495-X retracted]
  • Protein family

  • Orn/Lys/Arg decarboxylase class-I family (together with [protein|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|SpeA]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|SpeA]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2X3L] (from ''Staphylococcus aureus'', 36% identity) [Pubmed|20419351]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|22383849], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed in stationary phase
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B896 (yaaO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1895 NBRP B. subtilis, Japan]
  • BKE00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • BKK00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • References

  • 24529384,20876533,22541437,22383849,9987136,20419351,29615499