SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) lyase
32.49 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
mother cell metabolism, leucine utilization
3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,952,031 → 1,952,930

    The protein

    Catalyzed reaction/ biological activity

  • (S)-3-hydroxy-3-methylglutaryl-CoA --> acetyl-CoA + acetoacetate [Pubmed|19935659]
  • Protein family

  • HMG-CoA lyase family (single member, according to UniProt)
  • [SW|Domains]

  • Pyruvate carboxyltransferase domain (aa 7-274)
  • Structure

  • [PDB|1YDO]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials


  • BKE18230 (Δ[gene|EEEE69A98DFAA3327FBC04F1422E959D8B44AF20|yngG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATGGCATGGTCTTCCTCC, downstream forward: _UP4_TGATAAAAGGGAGGACGCAT
  • BKK18230 (Δ[gene|EEEE69A98DFAA3327FBC04F1422E959D8B44AF20|yngG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATGGCATGGTCTTCCTCC, downstream forward: _UP4_TGATAAAAGGGAGGACGCAT
  • References

  • 15699190,12662922,16330546,18943917,19935659