SubtiBank SubtiBank
ypzD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypzD

unknown
locus
BSU_23350
pI
9.82
mw
7.47 kDa
protein length
gene length
213 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,435,012 → 2,435,224

    The protein

    Protein family

  • [SW|GerPA/GerPF family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EEBAA8A29E6A4EDA1DA4B32605459B9272A4762D|ypzD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE23350 (Δ[gene|EEBAA8A29E6A4EDA1DA4B32605459B9272A4762D|ypzD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTATCAAGTCTCCTTT, downstream forward: _UP4_TAATGTATTCAATACACGGG
  • BKK23350 (Δ[gene|EEBAA8A29E6A4EDA1DA4B32605459B9272A4762D|ypzD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTATCAAGTCTCCTTT, downstream forward: _UP4_TAATGTATTCAATACACGGG