SubtiBank SubtiBank
yfhE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfhE

general stress protein, survival of salt, ethanol and paraquat stresses and low temperatures
locus
BSU08500
pI
10.57
mw
4.14 kDa
protein length
gene length
111 bp Sequence Blast
function
survival of stress conditions and low temperatures
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    924,468 → 924,578

    Expression and Regulation

    Operons

    genes
    [gene|B2924DAA879FBE56EB8DF9A7C60222AA1EE5526C|yfhF]-[gene|EE8065E719D0359B5892C8DCBCEC0B246ABE7D5B|yfhE]-[gene|29A9F7EEC3EFD8CA913877C41C1F00BCE9FF384D|yfhD]
    description
    [Pubmed|27965289]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|15699190]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|29A9F7EEC3EFD8CA913877C41C1F00BCE9FF384D|YfhD]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C360 (yfhE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2358 NBRP B. subtilis, Japan]
  • BKE08500 (Δ[gene|EE8065E719D0359B5892C8DCBCEC0B246ABE7D5B|yfhE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAGGACCTCCTTCA, downstream forward: _UP4_TAGGAATACATAGCCCCTTA
  • BKK08500 (Δ[gene|EE8065E719D0359B5892C8DCBCEC0B246ABE7D5B|yfhE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAGGACCTCCTTCA, downstream forward: _UP4_TAGGAATACATAGCCCCTTA
  • References

  • 15805528,15699190,22582280