SubtiBank SubtiBank
yfhE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfhE

general stress protein, survival of salt, ethanol and paraquat stresses and low temperatures
locus
BSU_08500
pI
10.57
mw
4.14 kDa
protein length
gene length
111 bp Sequence Blast
function
survival of stress conditions and low temperatures
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    924,468 → 924,578

    Expression and Regulation

    Operons

    genes
    [gene|B2924DAA879FBE56EB8DF9A7C60222AA1EE5526C|yfhF]-[gene|EE8065E719D0359B5892C8DCBCEC0B246ABE7D5B|yfhE]-[gene|29A9F7EEC3EFD8CA913877C41C1F00BCE9FF384D|yfhD]
    description
    [Pubmed|27965289]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|15699190]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|29A9F7EEC3EFD8CA913877C41C1F00BCE9FF384D|YfhD]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C360 (yfhE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2358 NBRP B. subtilis, Japan]
  • BKE08500 (Δ[gene|EE8065E719D0359B5892C8DCBCEC0B246ABE7D5B|yfhE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAGGACCTCCTTCA, downstream forward: _UP4_TAGGAATACATAGCCCCTTA
  • BKK08500 (Δ[gene|EE8065E719D0359B5892C8DCBCEC0B246ABE7D5B|yfhE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAGGACCTCCTTCA, downstream forward: _UP4_TAGGAATACATAGCCCCTTA
  • References

  • 15805528,15699190,22582280