SubtiBank SubtiBank
panD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

panD

aspartate 1-decarboxylase
locus
BSU22410
pI
5.56
mw
13.76 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
biosynthesis of coenzyme A
product
aspartate 1-decarboxylase
essential
no
ec
4.1.1.11
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.4|Biosynthesis of coenzyme A]
  • Gene

    Coordinates
    2,352,592 → 2,352,975

    The protein

    Catalyzed reaction/ biological activity

  • L-aspartate = beta-alanine + CO2 (according to Swiss-Prot)
  • Structure

  • [PDB|2C45] (from ''Mycobacterium tuberculosis'', 54% identity) [Pubmed|17001646]
  • Biological materials

    Mutant

  • BKE22410 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCGCTCATCATTGTTCGAT, downstream forward: _UP4_TAGAAGAAAAGCCCCCTTTA
  • BKK22410 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCGCTCATCATTGTTCGAT, downstream forward: _UP4_TAGAAGAAAAGCCCCCTTTA
  • References

  • 17001646,28589224, 26762040