SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


negative effector of [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK], controls cell wall metabolism
32.44 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
control of cell wall metabolism
negative effector of [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,149,667 → 4,150,509

    Phenotypes of a mutant

  • growth defect at high temperature, lysis at 49°C, this can be suppressed by mutations that reduce [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK] autokinase activity, by inactivation of [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE], or by overexpreesion of [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] or [protein|603E226CE488A25C4E28A6A7363CCD65BE64BB21|PdaC] [pubmed|29465029]
  • The protein


  • [PDB|2O3O], [Pubmed|17307848]
  • [SW|Localization]

  • cell membrane (according to UniProt), spotty close to the membrane [Pubmed|21219466]
  • Expression and Regulation




  • ''htrC'' transcript expressed during sporulation [Pubmed|9829949]
  • view in new tab

    Biological materials


  • MGNA-B825 (yycI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40380 (Δ[gene|EE681C9A42FCC29CBB55CC9566EE4CFF986D0F1D|walI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCAACGATGAAGATTGATT, downstream forward: _UP4_TGAAAATAATGGAGTGAGAC
  • BKK40380 (Δ[gene|EE681C9A42FCC29CBB55CC9566EE4CFF986D0F1D|walI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCAACGATGAAGATTGATT, downstream forward: _UP4_TGAAAATAATGGAGTGAGAC
  • References


  • 28886686
  • Original publications

  • 17307850,17350627,17307848,9829949,18408157,21219466,29465029