SubtiBank SubtiBank
ymcA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ymcA

subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex, required for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] dependent maturation of polycistronic mRNAs, antagonist of biofilm repression by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], control of the [SW|phosphorelay]
locus
BSU_17020
pI
5.09
mw
16.02 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
control of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] activity, see [SW|Targets of the Y complex]
product
subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex
essential
no
synonyms
ricA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.5|Effectors of RNA degradation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.6|Other protein controlling the activity of the phosphorelay]
  • Gene

    Coordinates
    1,774,374 → 1,774,805

    Phenotypes of a mutant

  • strongly reduced [SW|genetic competence], strongly reduced [SW|sporulation] [Pubmed|23490197]
  • defective in [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-mediated maturation of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • The protein

    Catalyzed reaction/ biological activity

  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex acts as specificity factor for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent processing of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex stimulates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation in the [category|SW 4.2.2|phosphorelay] [pubmed|27501195]
  • [SW|Cofactors]

  • one 4Fe-4S cluster (contributes to the co-ordination of the cluster (with [protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF] and [protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT])) [pubmed|31530674]
  • Structure

  • [PDB|6PRH] (the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]dimer) [pubmed|31530674]
  • [PDB|6PRK] (the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF] complex) [pubmed|31530674]
  • [SW|Localization]

  • cytoplasm [pubmed|27501195]
  • Expression and Regulation

    Operons

    genes
    [gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]-[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17020 (Δ[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17020 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_GTCTTTTTTTGAGTAGAGCG, downstream forward: _UP4_TAAACACGGTGCCTTTACAG
  • BKK17020 (Δ[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTTTTTTGAGTAGAGCG, downstream forward: _UP4_TAAACACGGTGCCTTTACAG
  • References

    Reviews

  • 32061882,32156829,32156813
  • Original publications

  • 15661000,23490197,15175311,26434553,28295778,27501195,29794222,30265683,31530674