SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


phosphotransferase system (PTS) mannitol-specific enzyme IIA component
16.00 kDa
protein length
143 aa Sequence Blast
gene length
429 bp Sequence Blast
uptake of mannitol
phosphotransferase system(PTS) mannitol-specific enzyme IIA component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of mannitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    451,185 → 451,616

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22014119], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]: activation, [Pubmed|20444094], in [regulon|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR regulon]
  • regulation

  • induced by mannitol ([protein|search|MtlR]) [Pubmed|20444094]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mtlD]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC, downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
  • BKK03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC, downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
  • References

  • 12897001,20444094