SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


mannitol-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIA of the [category|SW 1.2.2|PTS]
16.00 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
mannitol uptake and phosphorylation
mannitol-specific [category|SW 1.2.2|PTS], EIIA

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of mannitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    451,185 → 451,616

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]
  • [SW|Domains]

  • [SW|PTS EIIA domain] type-2 (aa 2-142) (according to UniProt)
  • Structure

  • [PDB|1A3A] (from E. coli, 41% identity) [pubmed|9551558]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22014119], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]: activation, [Pubmed|20444094], in [regulon|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR regulon]
  • regulation

  • induced by mannitol ([protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]) [Pubmed|20444094]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC, downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
  • BKK03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC, downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
  • References

  • 12897001,20444094,9551558