SubtiBank SubtiBank
prsW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

prsW

protease, cleaves [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] in the presence of antimicrobial peptides
locus
BSU22940
pI
8.09
mw
24.57 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
function
control of [SW|SigW] activity
product
protease
essential
no
synonyms
ypdC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,400,208 → 2,400,864

    The protein

    Protein family

  • protease prsW family (according to Swiss-Prot)
  • [SW|Localization]

  • membrane [Pubmed|17020587]
  • Expression and Regulation

    Operons

    genes
    [gene|EE3B6B52EA19958E2E46A1545747F5209A6AA036|prsW]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A418 (ypdC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/418 NBRP B. subtilis, Japan]
  • BKE22940 (Δ[gene|EE3B6B52EA19958E2E46A1545747F5209A6AA036|prsW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCAACCTCTTTCCT, downstream forward: _UP4_TAGAAGCCGCACAGCAACCG
  • BKK22940 (Δ[gene|EE3B6B52EA19958E2E46A1545747F5209A6AA036|prsW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCAACCTCTTTCCT, downstream forward: _UP4_TAGAAGCCGCACAGCAACCG
  • labs

  • [SW|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas%20Wiegert-Dateien/Thomas%20Wiegert.html Homepage]
  • References

    Reviews

  • 22688815,23479438,22381678,29343670
  • Original publications

  • 16816000,17020587,19889088,23155385