SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


protease, cleaves [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] in the presence of antimicrobial peptides
24.57 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
control of [SW|SigW] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,400,208 → 2,400,864

    The protein

    Protein family

  • protease prsW family (single member, according to UniProt)
  • [SW|Localization]

  • membrane [Pubmed|17020587]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A418 (ypdC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22940 (Δ[gene|EE3B6B52EA19958E2E46A1545747F5209A6AA036|prsW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCAACCTCTTTCCT, downstream forward: _UP4_TAGAAGCCGCACAGCAACCG
  • BKK22940 (Δ[gene|EE3B6B52EA19958E2E46A1545747F5209A6AA036|prsW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCAACCTCTTTCCT, downstream forward: _UP4_TAGAAGCCGCACAGCAACCG
  • labs

  • [SW|Thomas Wiegert], University of Bayreuth, Germany [ Homepage]
  • References


  • 22688815,23479438,22381678,29343670
  • Original publications

  • 16816000,17020587,19889088,23155385