SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


7.17 kDa
protein length
gene length
195 bp Sequence Blast
excision of the conjugative transposon ICEBs1 from the trnS-leu2 locus
ydzC, sacV

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    531,787 → 531,981

    The protein

    Catalyzed reaction/ biological activity

  • excision of conjugative transposon [Pubmed|18005101]
  • Additional information

  • Was reported to be involved in the regulation of the levansucrase gene (''[gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]'')
  • Expression and Regulation



    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • view in new tab

    Biological materials


  • BKE04830 (Δ[gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATCACCTCCTCGTT, downstream forward: _UP4_AAAGGCCCAAAATCTCAAAC
  • BKK04830 (Δ[gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATCACCTCCTCGTT, downstream forward: _UP4_AAAGGCCCAAAATCTCAAAC
  • References

  • 18005101,17511812