SubtiBank SubtiBank
znuB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

znuB

high-affinity [SW|ABC transporter] for zinc (permease)
locus
BSU02870
pI
10.38
mw
30.28 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
zinc uptake
product
[SW|ABC transporter] for zinc (permease)
essential
no
synonyms
yceA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.6|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.3|Zinc]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    310,000 → 310,842

    Phenotypes of a mutant

  • reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
  • reduced expression of the ''[gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]'' operon [Pubmed|21813502]
  • The protein

    Protein family

  • ABC-3 integral membrane protein family (with [protein|1B7C4AD6CD0632051A0E8CA57034872D13FF67F9|MntC] and [protein|F7DA077FE47DBB409BE2B1D9F12A9D719C246166|MntD], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]-[gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]-[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]
    description
    [Pubmed|9811636]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by zinc starvation ([protein|search|Zur]) [Pubmed|12426338]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B982 (yceA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1981 NBRP B. subtilis, Japan]
  • BKE02870 (Δ[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACGGCGATCATGCCGC, downstream forward: _UP4_TAACATGAAAAGCAGTTTTC
  • BKK02870 (Δ[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACGGCGATCATGCCGC, downstream forward: _UP4_TAACATGAAAAGCAGTTTTC
  • References

  • 12426338,9811636,10092453,21813502,12426338,27561249