SubtiBank SubtiBank
yhdQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhdQ

putative transcriptional regulator ([SW|MerR family])
locus
BSU_09560
pI
7.89
mw
16.25 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|MerR family])
essential
no
synonyms
cueR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,033,458 → 1,033,889

    The protein

    Protein family

  • [SW|MerR family]
  • [SW|Domains]

  • [SW|HTH merR-type domain] (aa 11-79) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]-[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|yhdP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B484 (yhdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1483 NBRP B. subtilis, Japan]
  • BKE09560 (Δ[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGTTATAGTTATGAG, downstream forward: _UP4_TAAAACCATTTTATCTAACA
  • BKK09560 (Δ[gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGTTATAGTTATGAG, downstream forward: _UP4_TAAAACCATTTTATCTAACA
  • References

  • 15948947,14663075,18048925,22383849