SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


dipeptide [protein|search|ABC transporter] (permease)
35.65 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
uptake of dipeptides
dipeptide [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,362,174 → 1,363,136

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|OppBC subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|AppC], [protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|OppC]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 117-307) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1766371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|7783641], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by glucose (2.9-fold) [Pubmed|12850135]
  • view in new tab


    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials


  • BKE12940 (Δ[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTACAGGGAGATTCACAC, downstream forward: _UP4_GACCCTAAGCTGAGGAGGTA
  • BKK12940 (Δ[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTACAGGGAGATTCACAC, downstream forward: _UP4_GACCCTAAGCTGAGGAGGTA
  • References

  • 12618455,10092453,1766371,7783641,1766371