SubtiBank SubtiBank
csn
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csn

chitosanase
locus
BSU_26890
pI
8.89
mw
31.34 kDa
protein length
277 aa Sequence Blast
gene length
834 bp Sequence Blast
function
chitin degradation
product
chitosanase
essential
no
ec
3.2.1.132
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,747,984 → 2,748,817

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of beta-(1->4)-linkages between D-glucosamine residues in a partly acetylated chitosan (according to UniProt)
  • Protein family

  • glycosyl hydrolase 46 family (single member, according to UniProt)
  • Structure

  • [PDB|4OLT] (from Pseudomonas sp. 39% identity) [pubmed|24766439]
  • [SW|Localization]

  • extracellular (signal peptide), major constituent of the secretome [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|EDE47BF726A4D2F0A4E1D9481C97576650339F84|csn]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A240 (csn::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/240 NBRP B. subtilis, Japan]
  • BKE26890 (Δ[gene|EDE47BF726A4D2F0A4E1D9481C97576650339F84|csn]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACTTCCCCTTTCTA, downstream forward: _UP4_TAAGCAGTGAGGAAAAGAAA
  • BKK26890 (Δ[gene|EDE47BF726A4D2F0A4E1D9481C97576650339F84|csn]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACTTCCCCTTTCTA, downstream forward: _UP4_TAAGCAGTGAGGAAAAGAAA
  • References

  • 11065371,18957862,22031025,20817675,12401130,24766439