SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


31.34 kDa
protein length
277 aa Sequence Blast
gene length
834 bp Sequence Blast
chitin degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,747,984 → 2,748,817

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of beta-(1->4)-linkages between D-glucosamine residues in a partly acetylated chitosan (according to UniProt)
  • Protein family

  • glycosyl hydrolase 46 family (single member, according to UniProt)
  • Structure

  • [PDB|4OLT] (from Pseudomonas sp. 39% identity) [pubmed|24766439]
  • [SW|Localization]

  • extracellular (signal peptide), major constituent of the secretome [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-A240 (csn::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26890 (Δ[gene|EDE47BF726A4D2F0A4E1D9481C97576650339F84|csn]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACTTCCCCTTTCTA, downstream forward: _UP4_TAAGCAGTGAGGAAAAGAAA
  • BKK26890 (Δ[gene|EDE47BF726A4D2F0A4E1D9481C97576650339F84|csn]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACTTCCCCTTTCTA, downstream forward: _UP4_TAAGCAGTGAGGAAAAGAAA
  • References

  • 11065371,18957862,22031025,20817675,12401130,24766439