SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


13.67 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    495,344 → 495,703

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C099 (ydbC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04420 (Δ[gene|EDD5CEDAE74D57627C32EB7C66966CE03B692274|ydbC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTTCACATATCATCTTTT, downstream forward: _UP4_TAATCAAAGCCCAAAACATC
  • BKK04420 (Δ[gene|EDD5CEDAE74D57627C32EB7C66966CE03B692274|ydbC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTTCACATATCATCTTTT, downstream forward: _UP4_TAATCAAAGCCCAAAACATC