SubtiBank SubtiBank
sbcC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sbcC

DNA exonuclease
locus
BSU_10650
pI
5.29
mw
128.70 kDa
protein length
1130 aa Sequence Blast
gene length
3393 bp Sequence Blast
function
DNA inter-strand cross-link repair
product
DNA exonuclease
essential
no
synonyms
yirY

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    1,144,749 → 1,148,141

    Phenotypes of a mutant

  • reduced resistance towards electron beams [pubmed|31948638]
  • The protein

    Protein family

  • SMC family (with [protein|0136394A52759CEEDD8DE074ED74033C6FFB8435|Smc], according to UniProt)
  • Structure

  • [PDB|6S6V] (from E. coli, corresponds to aa 1 ... 622, 27% identity) [pubmed|31492634]
  • [SW|Localization]

  • Nucleoid (Mid-cell) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]-[gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]-[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]-[gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B290 (yirY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1289 NBRP B. subtilis, Japan]
  • GP894 (''sbcCD''::''kan''), available in [SW|Stülke] lab [pubmed|22178973]
  • 1A898 ( ''sbcC''::''cat''), [Pubmed|16780573], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A898&Search=1A898 BGSC]
  • BKE10650 (Δ[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTAATGCTTAAGGCGATCG, downstream forward: _UP4_GAGTTGATGTAAGGGAGGAG
  • BKK10650 (Δ[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTAATGCTTAAGGCGATCG, downstream forward: _UP4_GAGTTGATGTAAGGGAGGAG
  • labs

  • [SW|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]
  • References

    Reviews

  • 19308706,22933559
  • Original publications

  • 16780573,11948146,16479537,22383849,21170359,30277537,31948638,31492634