SubtiBank SubtiBank
sbcC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sbcC

DNA exonuclease
locus
BSU_10650
pI
5.29
mw
128.70 kDa
protein length
1130 aa Sequence Blast
gene length
3393 bp Sequence Blast
function
DNA inter-strand cross-link repair
product
DNA exonuclease
essential
no
synonyms
yirY

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    1,144,749 → 1,148,141

    The protein

    Protein family

  • SMC family (with [protein|0136394A52759CEEDD8DE074ED74033C6FFB8435|Smc], according to UniProt)
  • [SW|Localization]

  • Nucleoid (Mid-cell) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]-[gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]-[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]-[gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B290 (yirY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1289 NBRP B. subtilis, Japan]
  • GP894 (''sbcCD''::''kan''), available in [SW|Stülke] lab
  • 1A898 ( ''sbcC''::''cat''), [Pubmed|16780573], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A898&Search=1A898 BGSC]
  • BKE10650 (Δ[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTAATGCTTAAGGCGATCG, downstream forward: _UP4_GAGTTGATGTAAGGGAGGAG
  • BKK10650 (Δ[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTAATGCTTAAGGCGATCG, downstream forward: _UP4_GAGTTGATGTAAGGGAGGAG
  • References

    Reviews

  • 19308706,22933559
  • Original publications

  • 16780573,11948146,16479537,22383849,21170359,30277537
  • Labs working on this gene/protein

  • [SW|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]