SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


PBSX prophage
27.02 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,338,957 → 1,339,616

    The protein


  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] at the C-terminus [Pubmed|18430080]
  • [SW|LysM domain] (aa 159-217) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12690 (Δ[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAGTCAAATGCAACGAC, downstream forward: _UP4_CCGCAATGAAACAGGTGATG
  • BKK12690 (Δ[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAGTCAAATGCAACGAC, downstream forward: _UP4_CCGCAATGAAACAGGTGATG
  • References


  • 18430080