SubtiBank SubtiBank
bmrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bmrA

multidrug [SW|ABC transporter] (ATP-binding protein)
locus
BSU_34820
pI
6.47
mw
64.34 kDa
protein length
589 aa Sequence Blast
gene length
1770 bp Sequence Blast
function
multiple antibiotic resistance
product
multidrug [SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yvcC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.1|Efflux of antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,577,745 → 3,579,514

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|YknU], [protein|E85814EDF232D21A42380D559EAD2CDFB41F19DB|YfiC], [protein|D5A3C316BD4567A0155F70330E32ACDE18F063FE|YwjA], [protein|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|YknV], [protein|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|YgaD], [protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|YfiB], [protein|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|BmrC]
  • [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • [SW|ABC transmembrane type-1 domain] (aa 29-309) (according to UniProt)
  • [SW|ABC transporter domain] (aa 341-576) (according to UniProt)
  • Structure

  • [PDB|4AYT] (human mitochondrial protein, 36% identity) [pubmed|23716676]
  • [SW|Localization]

  • membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]-[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21077936], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|21077936]
  • additional information

  • half-life of the mRNA: 1.5 min [PubMed|21077936]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B645 (yvcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1644 NBRP B. subtilis, Japan]
  • BKE34820 (Δ[gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTTTCCTCCTGTTT, downstream forward: _UP4_TAAATTTTGGTCGAATCAGC
  • BKK34820 (Δ[gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTTTCCTCCTGTTT, downstream forward: _UP4_TAAATTTTGGTCGAATCAGC
  • References

  • 16107340,15182191,15766260,16405427,12968023,10092453,18215075,12225846,20544182,11827477,21077936,21336797,21483854,27570617,28755379,29662596,23716676,24630999,31044174