SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Holliday junction resolvase, DNA repair, homologous recombination and chromosome segregation; recognizes, distorts, and cleaves four-stranded recombination intermediates and modulates [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] activities, required for efficient survival and replication restart after replication-transcription conflicts
23.81 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
[SW|DNA repair/ recombination] and [SW|chromosome segregation]
Holliday junction resolvase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Double strand breaks repair]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    2,340,802 → 2,341,422

    Phenotypes of a mutant

  • the inactivations of ''[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]'' and ''[gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]'' are synthetically lethal [Pubmed|24770420]
  • loss of plasmid transformation, this can be suppressed by deletion of [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] [pubmed|30050509]
  • The protein

    Catalyzed reaction/ biological activity

  • binds Holliday junctions with high affinity [Pubmed|24770420]
  • inhibits [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] filament growth, facilitates [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly from preformed filaments [pubmed|30050509]
  • Endonucleolytic cleavage at a junction such as a reciprocal single-stranded crossover between two homologous DNA duplexes (Holliday junction) (according to UniProt).
  • Protein family

  • RecU family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd]
  • Effectors of protein activity

  • [protein|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|RecU]-mediated Holliday junction resolution is stimulated by [protein|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|RuvB]-ATP [Pubmed|24770420]
  • Structure

  • [PDB|1ZP7] [Pubmed|16154091]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22211522], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive during vegetative growth [Pubmed|15758244]
  • view in new tab

    Biological materials


  • GP891 (''recU''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE22310 ( ''recU''::''ermC''), (available at the [ BGSC] and in [SW|Fabian Commichau]'s lab) [pubmed|28189581]
  • BP784 ( ''recU''::''ermC''), (available in [SW|Fabian Commichau]'s lab)
  • 1A895 (no resistance), [Pubmed|16020779], available at [ BGSC]
  • BKE22310 (Δ[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCATCCTCCTTAT, downstream forward: _UP4_TGATTAACGAAAGGTTGAGA
  • BKK22310 (Δ[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCATCCTCCTTAT, downstream forward: _UP4_TGATTAACGAAAGGTTGAGA
  • References


  • 22933559,9442895
  • Original publications

  • 9642195,16024744,15317759,11810266,19730681,19422832,7814321,18179421,16154091,21600217,18684995,16020779,24770420,24792171,14701911,25939832,27903910,30050509
  • RecU in other organisms

  • 23356868