SubtiBank SubtiBank
recU
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

recU

Holliday junction resolvase, DNA repair, homologous recombination and chromosome segregation; recognizes, distorts, and cleaves four-stranded recombination intermediates and modulates [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] activities, required for efficient survival and replication restart after replication-transcription conflicts
locus
BSU_22310
pI
9.51
mw
23.81 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
function
[SW|DNA repair/ recombination] and [SW|chromosome segregation]
product
Holliday junction resolvase
essential
no
synonyms
prfA,yppB,jopB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.4|Double strand breaks repair]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,340,802 → 2,341,422

    Phenotypes of a mutant

  • the inactivations of ''[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]'' and ''[gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]'' are synthetically lethal [Pubmed|24770420]
  • loss of plasmid transformation, this can be suppressed by deletion of [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] [pubmed|30050509]
  • The protein

    Catalyzed reaction/ biological activity

  • binds Holliday junctions with high affinity [Pubmed|24770420]
  • inhibits [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] filament growth, facilitates [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly from preformed filaments [pubmed|30050509]
  • endonucleolytic cleavage at a junction such as a reciprocal single-stranded crossover between two homologous DNA duplexes (Holliday junction) (according to UniProt)
  • promotes a net [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly from viral ssDNAs not homologous to the host genome [pubmed|31876108]
  • Protein family

  • RecU family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd]
  • Effectors of protein activity

  • [protein|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|RecU]-mediated Holliday junction resolution is stimulated by [protein|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|RuvB]-ATP [Pubmed|24770420]
  • Structure

  • [PDB|1ZP7] [Pubmed|16154091]
  • Expression and Regulation

    Operons

    genes
    [gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]-[gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]
    description
    [Pubmed|7814321]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22211522], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive during vegetative growth [Pubmed|15758244]
  • view in new tab

    Biological materials

    Mutant

  • GP891 (''recU''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE22310 ( ''recU''::''ermC''), (available at the [http://www.bgsc.org/ BGSC] and in [SW|Fabian Commichau]'s lab) [pubmed|28189581]
  • BP784 ( ''recU''::''ermC''), (available in [SW|Fabian Commichau]'s lab)
  • 1A895 (no resistance), [Pubmed|16020779], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A895&Search=1A895 BGSC]
  • BKE22310 (Δ[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCATCCTCCTTAT, downstream forward: _UP4_TGATTAACGAAAGGTTGAGA
  • BKK22310 (Δ[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCATCCTCCTTAT, downstream forward: _UP4_TGATTAACGAAAGGTTGAGA
  • References

    Reviews

  • 22933559,9442895
  • Original publications

  • 9642195,16024744,15317759,11810266,19730681,19422832,7814321,18179421,16154091,21600217,18684995,16020779,24770420,24792171,14701911,25939832,27903910,30050509,31876108
  • RecU in other organisms

  • 23356868