SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


anti-[SW|sigma factor] to [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]
32.72 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
control of [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] activity
anti-[SW|sigma factor] to [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,770,350 → 2,771,207

    The protein

    Catalyzed reaction/ biological activity

  • binds and thus inactivates [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]
  • Effectors of protein activity

  • RsiV directly binds lysozyme [Pubmed|25275625]
  • upon exposure to lysozyme, the extracellular domain of [protein|ED1DDA187692683D9862EC0E858B80CD56C48045|RsiV] is cleaved off by [protein|CDC6971F39F3EEAAE912CB1402EE1BD64D5A12A0|SipS] and [protein|search|SipT ](between A66 and M67), subsequently the N-terminal part of the protein is subject to intramemrane proteolysis by [protein|CB50289535EA537F63BADD459BD11AA7759A6658|RasP] [Pubmed|29358498,25275625,23687273]
  • Structure

  • [PDB|5JEN] (complex with lysozyme)
  • [SW|Localization]

  • membrane [Pubmed|23687273]
  • Expression and Regulation



    sigma factors

  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21856855], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • induced by lysozyme ([protein|search|SigV]) [Pubmed|21856855]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials


  • MGNA-A145 (yrhM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27130 (Δ[gene|ED1DDA187692683D9862EC0E858B80CD56C48045|rsiV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATTGCTGTAATCTCTTAT, downstream forward: _UP4_TAAAATAAAAACATCCATCT
  • BKK27130 (Δ[gene|ED1DDA187692683D9862EC0E858B80CD56C48045|rsiV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATTGCTGTAATCTCTTAT, downstream forward: _UP4_TAAAATAAAAACATCCATCT
  • References


  • 29343670,31286585
  • Original publications

  • 14993308,16274938,20817771,23687273,25275625,26399770,29358498,30020925