SubtiBank SubtiBank
yqcB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqcB

unknown
locus
BSU_25960
pI
4.69
mw
10.22 kDa
protein length
gene length
273 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,668,493 → 2,668,765

    Biological materials

    Mutant

  • BKE25960 (Δ[gene|ED1BC99ABB8389335E332ECC8BD511FB3E0E377E|yqcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCTCTCTATAAAGCTGTG, downstream forward: _UP4_ATTACTTTTGAGGTGGTTTA
  • BKK25960 (Δ[gene|ED1BC99ABB8389335E332ECC8BD511FB3E0E377E|yqcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCTCTCTATAAAGCTGTG, downstream forward: _UP4_ATTACTTTTGAGGTGGTTTA