SubtiBank SubtiBank
yqcB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqcB

unknown
locus
BSU_25960
pI
4.69
mw
10.22 kDa
protein length
gene length
273 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,668,493 → 2,668,765

    Biological materials

    Mutant

  • BKE25960 (Δ[gene|ED1BC99ABB8389335E332ECC8BD511FB3E0E377E|yqcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCTCTCTATAAAGCTGTG, downstream forward: _UP4_ATTACTTTTGAGGTGGTTTA
  • BKK25960 (Δ[gene|ED1BC99ABB8389335E332ECC8BD511FB3E0E377E|yqcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCTCTCTATAAAGCTGTG, downstream forward: _UP4_ATTACTTTTGAGGTGGTTTA