SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


C-terminal fragment of the Y family DNA polymerase [protein|A04F698C8836E84991BC875BCB7B1460D8E74A8E|YozK]-[protein|ED0A85A8A5FCD12C99507EB033F88586521A7C47|YobH]
23.06 kDa
protein length
217 aa Sequence Blast
gene length
655 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • The protein

    Protein family

  • [SW|DNA polymerase type-Y family] (according to UniProt)
  • [SW|Domains]

  • [SW|UmuC domain] (aa 1-68) (according to UniProt)
  • Structure

  • [PDB|4DEZ] (from Mycobacterium smegmatis, 24% identity) [pubmed|22868761]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-A306 (yobH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18930 (Δ[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCAGGATTCTCTT, downstream forward: _UP4_TGAGAAGTATCTCAGTTACG
  • BKK18930 (Δ[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCAGGATTCTCTT, downstream forward: _UP4_TGAGAAGTATCTCAGTTACG
  • References

  • 16267290,27766092,22868761,30916324