SubtiBank SubtiBank
yqeY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeY

unknown
locus
BSU_25400
pI
5.53
mw
16.62 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,619,910 → 2,620,356

    The protein

    Structure

  • [PDB|1NG6]
  • Expression and Regulation

    Operons

    genes
    [gene|4C79DEC2524735E3D32F967D511C5B0761D503A5|rpsU]-[gene|ED016475DF70DC63EE97B9FFD0CAC026E13A10E3|yqeY]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C436 (yqeY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2434 NBRP B. subtilis, Japan]
  • BKE25400 (Δ[gene|ED016475DF70DC63EE97B9FFD0CAC026E13A10E3|yqeY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGACTCATAAATCCACCCT, downstream forward: _UP4_TAAATGGCAAAGAAAAGGAC
  • BKK25400 (Δ[gene|ED016475DF70DC63EE97B9FFD0CAC026E13A10E3|yqeY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGACTCATAAATCCACCCT, downstream forward: _UP4_TAAATGGCAAAGAAAAGGAC