SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.62 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,619,910 → 2,620,356

    The protein


  • [PDB|1NG6]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C436 (yqeY::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE25400 (Δ[gene|ED016475DF70DC63EE97B9FFD0CAC026E13A10E3|yqeY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGACTCATAAATCCACCCT, downstream forward: _UP4_TAAATGGCAAAGAAAAGGAC
  • BKK25400 (Δ[gene|ED016475DF70DC63EE97B9FFD0CAC026E13A10E3|yqeY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGACTCATAAATCCACCCT, downstream forward: _UP4_TAAATGGCAAAGAAAAGGAC