phosphoglycerate kinase, glycolytic/ gluconeogenic enzyme, universally conserved protein
function
enzyme in glycolysis/ gluconeogenesis
product
phosphoglycerate kinase
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.2|Substrate-level phosphorylation][category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis][category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis][category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue][category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]Gene
Coordinates
3,480,197 → 3,481,381
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]poor growth [pubmed|28189581]poorly transformable [pubmed|28189581]The protein
Catalyzed reaction/ biological activity
ATP 3-phospho-D-glycerate = ADP 1,3-bisphosphoglycerate (according to Swiss-Prot)Protein family
phosphoglycerate kinase family (according to Swiss-Prot)Kinetic information
Two Substrate Reversible Michaelis-Menten [Pubmed|7154941][SW|Domains]
nucleotide binding domain (ATP) (350–353)2x substrate binding domain (21–23), (59–62)Modification
phosphorylation on Ser-183 AND Thr-299 [Pubmed|17218307], [Pubmed|17726680][SW|Cofactors]
Mg2 or Mn2 [Pubmed|7154941]Effectors of protein activity
Inhibited by Co2 , NDP and NMP [Pubmed|7154941]Structure
[PDB|1PHP] (from ''Geobacillus stearothermophilus'')Additional information
extensive information on the structure and enzymatic properties of Pgk can be found at [http://www.proteopedia.org/wiki/index.php/Phosphoglycerate_Kinase Proteopedia]belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]Biological materials
Mutant
GP699 (''pgk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]labGP707 (''pgk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]BKK33930 (Δ[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTAGGAGATCCTCCT, downstream forward: _UP4_TAATCTCAAAACTGCTATAAExpression vectors
pGP1102 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s labpGP95 (N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s labpGP91 (N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]pGP1513 (expression in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lablacZ fusion
pGP514 (in [protein|search|pAC6]), a series of promoter deletion variants is also available in [protein|search|pAC6], available in [SW|Jörg Stülke]'s labtwo-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available iin [SW|Jörg Stülke]'s lab, [pubmed|19193632]References
16479537,12850135,17726680,11489127,17505547,17218307,7154941,12682299,23420519,15378759,24825009,28189581