ylmD [2019-07-01 09:48:07]

peptidoglycan-editing factor, prevents incorporation of glycine or L-serine into the PG sacculi

Locus: BSU15370

Isoelectric point: 6.18

Molecular weight: 30.79 kDa

Protein length: 278 aa

Gene length: 837 bp

Function: quality control to maintain composition and integrity of peptidoglycan

Product: peptidoglycan-editing factor

Essential: no

Synonyms: pgeF

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of peptidoglycan
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of peptidoglycan

Gene

Coordinates: 1,609,327 → 1,610,163

Phenotypes of a mutant

• sensitive to ß-lactam antibiotics PubMed

The protein

Protein family

• UPF0124 family (according to Swiss-Prot)

Structure

• 1T8H (from Geobacillus stearothermophilus, 52% identity)

Expression and Regulation

Operons

• Genes: ylmD-ylmE-sepF-ylmG-ylmH
  Description: PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in Spo0A regulon

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed

Biological materials

Mutant

• MGNA-B125 (ylmD::erm), available at the NBRP B. subtilis, Japan
• BKE15370 (ΔylmD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGATCCAACCTTTCG, downstream forward: _UP4_GGAATGAAGGAGGCATAAAA
• BKK15370 (ΔylmD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGATCCAACCTTTCG, downstream forward: _UP4_GGAATGAAGGAGGCATAAAA

References

Loading